
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-284o19.8
- Ensembl ID:
- ENSDARG00000053836
- ZFIN ID:
- ZDB-GENE-070912-289
- Human Orthologue:
- GRINA
- Human Description:
- glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) [Sourc
- Mouse Orthologue:
- Grina
- Mouse Description:
- glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) Gene [
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11078 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11078
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075947 | Essential Splice Site | 159 | 300 | 3 | 6 |
ENSDART00000141447 | Essential Splice Site | 159 | 300 | 4 | 7 |
ENSDART00000145711 | Essential Splice Site | 29 | 135 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 2 (position 37597048)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 37876180 GRCz11 2 37858637 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CRGTGTCCTCCACGTTCAGTCGCAAACATCCCTGGAATCTGGTGGGACTG[G/A]TGAGTGTTTGGRTTAACATAAGAATATGAATGTTTRTGTCATGGTATAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: