vtnb

Ensembl ID:
ENSDARG00000053831
ZFIN ID:
ZDB-GENE-041116-1
Description:
vitronectin b [Source:RefSeq peptide;Acc:NP_001132933]
Mouse Orthologue:
Vtn
Mouse Description:
vitronectin Gene [Source:MGI Symbol;Acc:MGI:98940]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1963 Nonsense F2 line generated During 2018
sa12786 Essential Splice Site Available for shipment Available now
sa43699 Nonsense Mutation detected in F1 DNA During 2018
sa37363 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1963
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075935   None 449 1 9
ENSDART00000124377 Nonsense 6 469 1 10

The following transcripts of ENSDARG00000053831 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 37915855)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39035934
GRCz11 21 39080992
KASP Assay ID:
554-1951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGTCTGACCTGTCCTCTGYYGCTCCAACACRTTGCTGTTTCTAGAA[C/T]AAATCAAGCACTCGTTGCTCAYTGTGCCGTTAAACATGAAASTGGCGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075935 Essential Splice Site 179 449 4 9
ENSDART00000124377 Essential Splice Site 196 469 4 10

The following transcripts of ENSDARG00000053831 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 37909138)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39029217
GRCz11 21 39074275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTTTCACMCGCATCAACTGCCAGGGRAAAACATACATATTCAAGG[T/G]TTGTTTAAAATGATGTAATACTGAAGTGCCCYATTATGCGTCACAGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075935 Nonsense 243 449 6 9
ENSDART00000124377 Nonsense 260 469 6 10

The following transcripts of ENSDARG00000053831 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 37906981)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39027060
GRCz11 21 39072118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTTTTTATCCACAGGTGACCAGTACTACCAGTATGAGTTCAAACAT[C/T]AGCCGTCCCATGAAGAATGTGACCGCATGACCAAGTCCTCACCGTCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075935 Essential Splice Site 281 449 None 9
ENSDART00000124377 Essential Splice Site 298 469 None 10

The following transcripts of ENSDARG00000053831 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 37906865)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39026944
GRCz11 21 39072002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATCTGTATTGTGACTTTGACATATTTGATCTGGTCTTTCAAGGCGG[T/C]AAGTCTGTTATTAAATTCCATGACCAAATAAATACCATTAACTGGTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link