si:rp71-1g18.1

Ensembl ID:
ENSDARG00000053792
ZFIN ID:
ZDB-GENE-030131-5470
Description:
hypothetical protein LOC559922 [Source:RefSeq peptide;Acc:NP_001104632]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31292 Essential Splice Site Available for shipment Available now
sa32978 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075895 Essential Splice Site 70 384 2 4
ENSDART00000136387 Essential Splice Site 11 166 1 4
ENSDART00000145642 Essential Splice Site 143 457 2 4
Genomic Location (Zv9):
Chromosome 2 (position 37759721)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38074635
GRCz11 2 38056963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATTTACAATGCATGGTTGACCTTCCATGCACAATCCTCAAAGAAACC[G/A]TAGGTGGCGCTCATCTGTAGCTTTCTTGAGTTTTGTCAACTAAATTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075895 Nonsense 151 384 4 4
ENSDART00000136387 Nonsense 92 166 3 4
ENSDART00000145642 Nonsense 224 457 4 4
Genomic Location (Zv9):
Chromosome 2 (position 37767354)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38082268
GRCz11 2 38064596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGACACTTTGAGCCAATGGGACCTTAGCCTTGTGGATGTCAATCCTT[T/A]GCCCTCACTTGAAAAACCTGAAGCTCCTCATACCAGCGAAATGTCATTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link