wu:fc49f05

Ensembl ID:
ENSDARG00000053776
ZFIN IDs:
ZDB-GENE-030131-3687, ZDB-GENE-050522-124
Description:
DNA cross-link repair 1A [Source:RefSeq peptide;Acc:NP_001018385]
Human Orthologue:
DCLRE1A
Human Description:
DNA cross-link repair 1A [Source:HGNC Symbol;Acc:17660]
Mouse Orthologue:
Dclre1a
Mouse Description:
DNA cross-link repair 1A, PSO2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1930042]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11323 Nonsense Available for shipment Available now
sa8485 Nonsense Mutation detected in F1 DNA During 2018
sa12063 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075876 Nonsense 461 904 2 10
Genomic Location (Zv9):
Chromosome 12 (position 32108910)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30390015
GRCz11 12 30504917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGGCTCCTAGGAGGACTCAGATAAAGGCAGGTCCCTCTGGATTKAAA[C/T]AAACAGACATTGGGGTGTTTTTTGGCCTGAAGCCGCTRCATGAAAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075876 Nonsense 757 904 8 10
Genomic Location (Zv9):
Chromosome 12 (position 32102205)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30396720
GRCz11 12 30511622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTTTTATTTTTTNACTCTCTCACCTGTTTTTYTAGCTGTATCAGAAGTGT[T/A]GAGCTCTAAAGTATGTTTGTCCAAGGATAAGTATAACACCATGTGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075876 Essential Splice Site 803 904 8 10
Genomic Location (Zv9):
Chromosome 12 (position 32102064)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30396861
GRCz11 12 30511763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTCTGCCCAAGTGCAWGTGCTTCCTATGATGCAGATCAATTTCAAAG[T/C]GAGTTAAACCGCACATAAAACTTCTGTGACTATAATTCTGCTCTAAATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link