vgll2b

Ensembl ID:
ENSDARG00000053773
ZFIN ID:
ZDB-GENE-050809-113
Description:
vestigial like 2b [Source:RefSeq peptide;Acc:NP_001028267]
Human Orthologue:
VGLL1
Human Description:
vestigial like 1 (Drosophila) [Source:HGNC Symbol;Acc:20985]
Mouse Orthologue:
Vgll1
Mouse Description:
vestigial like 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2655768]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36431 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052446 Nonsense 197 288 3 4
Genomic Location (Zv9):
Chromosome 17 (position 27303665)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27427781
GRCz11 17 27444744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCGGGTCTGCCACACACACACCCGCACCCACACCCATCAGAGTCCTG[G/A]ACCTACTCCCAGAGCCAGACCTATCCCGCCCACCGGCCCCTTCACGAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link