
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ttll3
- Ensembl ID:
- ENSDARG00000053728
- ZFIN ID:
- ZDB-GENE-060616-182
- Description:
- Tubulin monoglycylase TTLL3 [Source:UniProtKB/Swiss-Prot;Acc:Q1ECV4]
- Human Orthologues:
- RP11-266J6.1, TTLL3
- Human Descriptions:
- ARPC4-TTLL3 fusion protein [Source:RefSeq peptide;Acc:NP_001185722]
- tubulin tyrosine ligase-like family, member 3 [Source:HGNC Symbol;Acc:24483]
- Mouse Orthologue:
- Ttll3
- Mouse Description:
- tubulin tyrosine ligase-like family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2141418]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40756 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa15000 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa40756
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103992 | Essential Splice Site | 115 | 771 | 5 | 13 |
ENSDART00000130665 | Essential Splice Site | 133 | 789 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 6 (position 40278273)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 40349873 GRCz11 6 40347409 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGGAGGTCGAGAGGGATGATGAAGCAGAGGATCTGTATGACCTAATGG[T/C]ATGTTTAGACTGTAAAATCCCATTCTAATGACAGTTGAACATTAATCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15000
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103992 | Nonsense | 688 | 771 | 13 | 13 |
ENSDART00000130665 | Nonsense | 706 | 789 | 13 | 13 |
- Genomic Location (Zv9):
- Chromosome 6 (position 40260483)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 40332083 GRCz11 6 40329619 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACCTTCAACCTGTTGCRTTCTTCCAAACCCAACAGAACTTCATCATCCA[C/T]AAAGACTATCCCACACTCAGCCCCAATCAGATYGCCCTCACACACACAGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: