wu:fc17g12

Ensembl ID:
ENSDARG00000053668
ZFIN ID:
ZDB-GENE-030131-2785
Human Orthologue:
STAG2
Human Description:
stromal antigen 2 [Source:HGNC Symbol;Acc:11355]
Mouse Orthologue:
Stag2
Mouse Description:
stromal antigen 2 Gene [Source:MGI Symbol;Acc:MGI:1098583]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35700 Nonsense Available for shipment Available now
sa39003 Nonsense Mutation detected in F1 DNA During 2018
sa35701 Nonsense Available for shipment Available now
sa44808 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088094 Nonsense 179 1269 6 33
Genomic Location (Zv9):
Chromosome 14 (position 29517555)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28191475
GRCz11 14 28497433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCAAGTCTAGTTTCTGTGAGTTTATTGGCGTGTTGGTGCGGCAGTG[T/A]CAGTACAGCATCATCTATGATGAGTACATGATGGACACAGTCATCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088094 Nonsense 495 1269 14 33
Genomic Location (Zv9):
Chromosome 14 (position 29524700)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28198620
GRCz11 14 28504578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTGTGCAGCAGAGCTCCTGAAGGACTGGGAATGCATGATCAGCTTGT[T/A]ACTGGATGAGCCACTGCCTGGAGAGGAAGGTCTGACCCTGTGACCCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088094 Nonsense 598 1269 17 33
Genomic Location (Zv9):
Chromosome 14 (position 29527692)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28201612
GRCz11 14 28507570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAACTGCCTCAGTTTTTTGATCTGGAGATCTACACCACAGGGCGTT[T/A]AGAAAAGGTTTGAGCAAAGAACAAATACACTGAATGATTTTTCTTATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088094 Nonsense 851 1269 24 33
Genomic Location (Zv9):
Chromosome 14 (position 29533266)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28207186
GRCz11 14 28513144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAAACAGATGGACAGCAGGATGATGAAGCTGGAAAAATCGAAGCTT[T/A]GCACAAGAGGCGAAATCTGCTGGCCGCATACTGCAAACTGATTATTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link