zgc:73142

Ensembl ID:
ENSDARG00000053663
ZFIN ID:
ZDB-GENE-030131-3694
Description:
neuron-specific protein family member 2 [Source:RefSeq peptide;Acc:NP_957167]
Human Orthologue:
AC011333.1
Human Description:
Neuron-specific protein family member 2 [Source:UniProtKB/Swiss-Prot;Acc:Q9Y328]
Mouse Orthologue:
Nsg2
Mouse Description:
neuron specific gene family member 2 Gene [Source:MGI Symbol;Acc:MGI:1202070]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17868 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075738 Essential Splice Site 43 183 2 5
Genomic Location (Zv9):
Chromosome 21 (position 40218490)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41444545
GRCz11 21 41305118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCACGCCCTTGGATGTTACTAATCTTCAGTATCAAGCMCCAGACAAG[G/A]TAAGGAACATTTCAGGTCTTATGTAATAGGATCTTNNACCTCTTTGYTAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link