zgc:152691

Ensembl ID:
ENSDARG00000053644
ZFIN ID:
ZDB-GENE-060929-556
Description:
aspartate aminotransferase 1 [Source:RefSeq peptide;Acc:NP_001116776]
Human Orthologue:
GOT1L1
Human Description:
glutamic-oxaloacetic transaminase 1-like 1 [Source:HGNC Symbol;Acc:28487]
Mouse Orthologue:
Got1l1
Mouse Description:
glutamic-oxaloacetic transaminase 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1923865]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12955 Essential Splice Site Available for shipment Available now
sa21350 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075708 Essential Splice Site 330 423 6 8
ENSDART00000140966   None 241 None 4
Genomic Location (Zv9):
Chromosome 8 (position 38877021)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37732436
GRCz11 8 37764870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGTGGTTGCCACTATTCTAAGTAAYCCTGCTCATCTGGTAGAGTGG[T/A]AAGATCAAATGCATTATGCATTACGCAAAATATTTATGTTGTATTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075708 Nonsense 380 423 8 8
ENSDART00000140966   None 241 None 4
Genomic Location (Zv9):
Chromosome 8 (position 38883472)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37738887
GRCz11 8 37771321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAACTTTCAAGAAAGTAATTCTTTCTTACCTTCTTTGTCAGTTCAA[C/T]AGGTTGAGTTTCTGGTTCAGAAGAAACACATCTACTTATTACCCAACGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link