
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101785
- Ensembl ID:
- ENSDARG00000053593
- ZFIN ID:
- ZDB-GENE-041010-152
- Description:
- hypothetical protein LOC450032 [Source:RefSeq peptide;Acc:NP_001006053]
- Human Orthologue:
- ANXA9
- Human Description:
- annexin A9 [Source:HGNC Symbol;Acc:547]
- Mouse Orthologue:
- Anxa9
- Mouse Description:
- annexin A9 Gene [Source:MGI Symbol;Acc:MGI:1923711]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31038 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa23607 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31038
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075643 | Essential Splice Site | 49 | 326 | 4 | 13 |
- Genomic Location (Zv9):
- Chromosome 19 (position 50035548)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 48633504 GRCz11 19 48292898 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGTGCGTGTGTGTGTGTGTCTGTGTGTCTGTGTATGCATGTGTATTCC[A/T]GATGTGAGCAGTGTTGTGAGGACTCTGAGCAATCGCAGTAACGCTCAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23607
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075643 | Essential Splice Site | 252 | 326 | 10 | 13 |
- Genomic Location (Zv9):
- Chromosome 19 (position 50029879)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 48639173 GRCz11 19 48298567 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTCAGAGGATTAATGTCTGCTGACCTCAGGAAGGGCCTCAAGACCCTGG[G/A]TAACCCTGTGTGTGTGCGCACACCTTGTGTTCCTTACATTATAAGGACCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
- Melanoma: Genome-wide association study identifies a new melanoma susceptibility locus at 1q21.3. (View Study)
- Melanoma: Genome-wide association study identifies novel loci predisposing to cutaneous melanoma. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: