zgc:162485

Ensembl ID:
ENSDARG00000053575
ZFIN ID:
ZDB-GENE-050309-118
Description:
hypothetical protein LOC558437 [Source:RefSeq peptide;Acc:NP_001082849]
Human Orthologue:
GPAT2
Human Description:
glycerol-3-phosphate acyltransferase 2, mitochondrial [Source:HGNC Symbol;Acc:27168]
Mouse Orthologue:
Gpat2
Mouse Description:
glycerol-3-phosphate acyltransferase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:2684962]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38705 Nonsense Mutation detected in F1 DNA During 2018
sa13863 Essential Splice Site, Missense Available for shipment Available now
sa7153 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41270 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075620 Nonsense 227 787 8 22
ENSDART00000123288 Nonsense 29 378 1 8
ENSDART00000129344 Nonsense 227 787 8 22
ENSDART00000141349 Nonsense 29 589 1 15
Genomic Location (Zv9):
Chromosome 8 (position 43124272)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41070259
GRCz11 8 41104231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGCATCGATCACGCTCTTATTTGTCTCACTCTCTTCTGCCACAACT[T/A]GAGGGTTCCCTACACCATTTTTCCAGCCCACGTTCGACAAACCTGGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075620 Essential Splice Site 551 787 15 22
ENSDART00000123288 Missense 354 378 8 8
ENSDART00000129344 Essential Splice Site 551 787 15 22
ENSDART00000141349 Essential Splice Site 353 589 8 15
Genomic Location (Zv9):
Chromosome 8 (position 43163253)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41109240
GRCz11 8 41143212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGCAGTGCGATGTGATCACTCGTGTCTTCATACACGAGGCTGTAGGAG[G/A]TAGGCTTTGTGTGTTGGAGATCGAATGGAGGCAAGGAAACTTAATGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075620 Essential Splice Site 625 787 17 22
ENSDART00000123288   None 378 None 8
ENSDART00000129344 Essential Splice Site 625 787 17 22
ENSDART00000141349 Essential Splice Site 427 589 10 15
Genomic Location (Zv9):
Chromosome 8 (position 43172872)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41118859
GRCz11 8 41152831
KASP Assay ID:
554-4725.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGTTGTGGACAGCATGGTGCGCTGTGGGGTTCTGGTTATGGAGGAGG[T/C]AAAGACACCTGCTTTAACAAACACATACATTCATCCTCTGATCACAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075620 Essential Splice Site 667 787 18 22
ENSDART00000123288   None 378 None 8
ENSDART00000129344 Essential Splice Site 667 787 18 22
ENSDART00000141349 Essential Splice Site 469 589 11 15
Genomic Location (Zv9):
Chromosome 8 (position 43176644)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41122631
GRCz11 8 41156603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAGCAGCGATTCAGACTGTGAGGAACCAGACATACACACCTACAAGG[T/C]ATACACTTGTGCAAACATCTTTTAATATATCAAATTTACCATATATATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link