wdr76

Ensembl ID:
ENSDARG00000053554
ZFIN ID:
ZDB-GENE-030131-4513
Description:
WD repeat-containing protein 76 [Source:RefSeq peptide;Acc:NP_001185496]
Human Orthologue:
WDR76
Human Description:
WD repeat domain 76 [Source:HGNC Symbol;Acc:25773]
Mouse Orthologue:
Wdr76
Mouse Description:
WD repeat domain 76 Gene [Source:MGI Symbol;Acc:MGI:1926186]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40915 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075588 Essential Splice Site 180 535 6 16
Genomic Location (Zv9):
Chromosome 7 (position 31540490)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29932832
GRCz11 7 30203982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGTACCACTGCTACAGAATTTACCTTTCCTACAACCTATGAGCTTG[T/G]AAGTCATGTGTCATTTAAAAATAAATAAATAAAAAAATTTACACTGAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link