wu:fc07b10

Ensembl ID:
ENSDARG00000053544
ZFIN ID:
ZDB-GENE-030131-2412
Human Orthologue:
HSPA4L
Human Description:
heat shock 70kDa protein 4-like [Source:HGNC Symbol;Acc:17041]
Mouse Orthologue:
Hspa4l
Mouse Description:
heat shock protein 4 like Gene [Source:MGI Symbol;Acc:MGI:107422]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36496 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36495 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075574 Essential Splice Site 603 833 15 20
Genomic Location (Zv9):
Chromosome 17 (position 43484457)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43449132
GRCz11 17 43439670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCGTCAGCTGGATCGAGATGTGCTCACCCATTTTGTTGAATATGAAG[T/C]GAGTCTAGTGCTTTTTCCATTTACATTTAGCCTGCCTCATTTCCCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075574 Nonsense 631 833 16 20
Genomic Location (Zv9):
Chromosome 17 (position 43482357)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43447032
GRCz11 17 43437570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGGAATGATGCCAAAAATGGCGTGGAGGAGTACGTTTACGACCTG[C/T]GAGACAAGCTGTGTGGCATCTACGAGAAATATGTCACTGAAGATGTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link