wu:fb77g05

Ensembl ID:
ENSDARG00000053517
ZFIN ID:
ZDB-GENE-030131-1677
Human Orthologue:
EML5
Human Description:
echinoderm microtubule associated protein like 5 [Source:HGNC Symbol;Acc:18197]
Mouse Orthologue:
Eml5
Mouse Description:
echinoderm microtubule associated protein like 5 Gene [Source:MGI Symbol;Acc:MGI:2442513]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42987 Nonsense Mutation detected in F1 DNA During 2018
sa9672 Essential Splice Site Available for shipment Available now
sa12262 Nonsense Available for shipment Available now
sa10880 Nonsense Available for shipment Available now
sa23160 Nonsense Available for shipment Available now
sa36492 Nonsense Mutation detected in F1 DNA During 2018
sa11871 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112088 Nonsense 760 1908 18 44
Genomic Location (Zv9):
Chromosome 17 (position 43191557)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43156232
GRCz11 17 43146770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAAAGGGGAAGTAAGGATAAGATATTTGTTATTAAAATCAACCCCTA[C/A]ATGCCAGACAAGCTGATCAGCGCTGGAGTGAAGCATATGAAGTTTTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112088 Essential Splice Site 780 1908 18 44
Genomic Location (Zv9):
Chromosome 17 (position 43191497)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43156172
GRCz11 17 43146710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTGATCAGCGCWGGAGTGAAGCATATGAAGTTTTGGCACCGAGCAGG[T/C]AAGACTATAAAGTGAGTCACTCTTGTGAAGCTTGTGAATACCTAAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112088 Nonsense 1247 1908 28 44
ENSDART00000112088 Nonsense 1247 1908 28 44
Genomic Location (Zv9):
Chromosome 17 (position 43127441)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43092116
GRCz11 17 43082654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGAGAGAAYGAGATYGTCTATGTAATCAAAGCCTTATCTACAAACATG[C/T]GACCCATGACGGGGGYCAAGCCCCATTTAYAACAGAAGGAGCCAACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112088 Nonsense 1247 1908 28 44
ENSDART00000112088 Nonsense 1247 1908 28 44
Genomic Location (Zv9):
Chromosome 17 (position 43127441)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43092116
GRCz11 17 43082654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGAGAGAAYGAGATYGTCTATGTAATCAAAGCCTTATCTACAAACATG[C/T]GACCCATGACGGGGGYCAAGCCCCATTTAYAACAGAAGGAGCCAACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112088 Nonsense 1274 1908 30 44
Genomic Location (Zv9):
Chromosome 17 (position 43122125)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43086800
GRCz11 17 43077338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATTACTGATGTAAGTCTGATTAAGTTGCTGTGTTTTGTTTGGGTGC[A/T]GACCCCCAGTGAGCAGGGCTCCACCAATGCCAGAAAAACTACAAACCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112088 Nonsense 1670 1908 39 44
Genomic Location (Zv9):
Chromosome 17 (position 43113443)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43078118
GRCz11 17 43068656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTGATTGAGATGTGCTCTTGTGTGGAACAACAGAAGATGCTGAAT[A/T]AAGTGAACCTCGGTCATCCGGCACGAACCGTCAGCTACAGTCCAGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112088 Essential Splice Site 1723 1908 39 44
Genomic Location (Zv9):
Chromosome 17 (position 43113282)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43077957
GRCz11 17 43068495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATTTGGGGAAAGAAGAGAGATCGCCGCTCTGCCATACARGATATCAG[G/A]TCAGACTGAGGAAAGTTGTTTATTATTATTATGAGWCAAAAANAAAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link