
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cbsa
- Ensembl ID:
- ENSDARG00000053500
- ZFIN ID:
- ZDB-GENE-050417-367
- Description:
- cystathionine-beta-synthase a [Source:RefSeq peptide;Acc:NP_001104702]
- Human Orthologue:
- CBS
- Human Description:
- cystathionine-beta-synthase [Source:HGNC Symbol;Acc:1550]
- Mouse Orthologue:
- Cbs
- Mouse Description:
- cystathionine beta-synthase Gene [Source:MGI Symbol;Acc:MGI:88285]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10945 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10945
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053932 | Nonsense | 244 | 571 | 6 | 15 |
ENSDART00000126746 | None | 84 | 5 | 6 |
The following transcripts of ENSDARG00000053500 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 28010679)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 28276237 GRCz11 1 29080069 - KASP Assay ID:
- 2259-0660.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTCATATTCTGGACCAATATCGCAATCCCAGCAACCCCCTGGCTCATTA[T/A]GACACCACTGCAGAGGAAATTCTGGAGCAATGTGATGGTAGTTGTTTTANNT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Homocysteine levels: Novel associations of CPS1, MUT, NOX4, and DPEP1 with plasma homocysteine in a healthy population: a genome-wide evaluation of 13 974 participants in the Women's Genome Health Study. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: