zgc:92177

Ensembl ID:
ENSDARG00000053496
ZFIN ID:
ZDB-GENE-041114-189
Description:
gem-associated protein 8 [Source:RefSeq peptide;Acc:NP_001007318]
Human Orthologue:
GEMIN8
Human Description:
gem (nuclear organelle) associated protein 8 [Source:HGNC Symbol;Acc:26044]
Mouse Orthologues:
Gemin8, Gm5455
Mouse Descriptions:
gem (nuclear organelle) associated protein 8 Gene [Source:MGI Symbol;Acc:MGI:2384300]
predicted pseudogene 5455 Pseudogene [Source:MGI Symbol;Acc:MGI:3646920]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31207 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053933 Nonsense 120 217 2 3
ENSDART00000131124 Nonsense 120 217 3 4
ENSDART00000142350 Nonsense 120 217 3 4

The following transcripts of ENSDARG00000053496 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 27991146)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28256704
GRCz11 1 29060536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCTTGAGTGTGATGTCAGCAACATGGACATCTCAGAAGAGCTGCGA[C/T]AATACTTTGCTCAGACAGAACGACACAGGCAGGAACTTAGTAAGTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link