syne2b

Ensembl ID:
ENSDARG00000053484
ZFIN ID:
ZDB-GENE-071218-5
Description:
Novel protein similar to H.sapiens SYNE1, spectrin repeat containing, nuclear envelope 1 (SYNE1) [So
Human Orthologue:
SYNE2
Human Description:
spectrin repeat containing, nuclear envelope 2 [Source:HGNC Symbol;Acc:17084]
Mouse Orthologue:
Syne2
Mouse Description:
synaptic nuclear envelope 2 Gene [Source:MGI Symbol;Acc:MGI:2449316]

Alleles

There are 40 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42265 Nonsense Mutation detected in F1 DNA During 2018
sa42264 Nonsense Mutation detected in F1 DNA During 2018
sa22358 Nonsense Available for shipment Available now
sa31955 Essential Splice Site Available for shipment Available now
sa28173 Nonsense Mutation detected in F1 DNA During 2018
sa8900 Nonsense Mutation detected in F1 DNA During 2018
sa42263 Nonsense Mutation detected in F1 DNA During 2018
sa31954 Nonsense Available for shipment Available now
sa42262 Nonsense Mutation detected in F1 DNA During 2018
sa22357 Nonsense Available for shipment Available now
sa16388 Nonsense Available for shipment Available now
sa42261 Nonsense Mutation detected in F1 DNA During 2018
sa28172 Nonsense Mutation detected in F1 DNA During 2018
sa11835 Essential Splice Site Available for shipment Available now
sa13694 Essential Splice Site Available for shipment Available now
sa42260 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31953 Nonsense Mutation detected in F1 DNA During 2018
sa16245 Nonsense Available for shipment Available now
sa35561 Nonsense Mutation detected in F1 DNA During 2018
sa35560 Nonsense Mutation detected in F1 DNA During 2018
sa22356 Nonsense Available for shipment Available now
sa42259 Essential Splice Site Mutation detected in F1 DNA During 2018
sa2693 Essential Splice Site F2 line generated During 2018
sa8449 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19067 Nonsense Mutation detected in F1 DNA During 2018
sa9847 Nonsense Available for shipment Available now
sa38966 Nonsense Mutation detected in F1 DNA During 2018
sa42258 Nonsense Mutation detected in F1 DNA During 2018
sa16713 Nonsense Available for shipment Available now
sa42257 Nonsense Mutation detected in F1 DNA During 2018
sa7376 Missense Mutation detected in F1 DNA During 2018
sa11394 Essential Splice Site Available for shipment Available now
sa31952 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38965 Nonsense Mutation detected in F1 DNA During 2018
sa22355 Nonsense Mutation detected in F1 DNA During 2018
sa6326 Nonsense Mutation detected in F1 DNA During 2018
sa8857 Nonsense Mutation detected in F1 DNA During 2018
sa22354 Nonsense Available for shipment Available now
sa22353 Nonsense Available for shipment Available now
sa9190 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 36 9778 3 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734 Nonsense 8 281 1 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37652055)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37128867
GRCz11 13 37254757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGTTTTCACTCTCTGCTCTTCCCTCAGTGGAGCAGGAACAAATTCAG[A/T]AGAGAACCTTCACCAACTGGATTAATGCCCAGCTGTCTAAGGTGAGGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 131 9778 6 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734 Nonsense 102 281 4 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37647123)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37123935
GRCz11 13 37249825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCGGATATCATGGATGGCAAACCATCCATCATTTTGGGTCTGGTCT[G/A]GACAATTATCATGCACATTCATGTAAGTTTACTCAATATTAATATTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 242 9778 8 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734 Nonsense 213 281 6 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37646582)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37123394
GRCz11 13 37249284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGATACTTCATGCTCTAAGGCCAAATATAGTTGACCTAACCAGAGCT[C/T]GAACAAGAACAAACAGACAAAACCTGGAGGAAGCCTTCCACATTGCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 270 9778 8 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734 Essential Splice Site 241 281 6 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37646494)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37123306
GRCz11 13 37249196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACATTGCTGAGAGAGAACTTCATATACCCAGACTGCTAGATCCAGCAG[G/A]TAAGTCTGTTAGGCCTTGAAAATGTATGCTTTGTATATGCAGTATATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 382 9778 12 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37640495)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37117307
GRCz11 13 37243197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACATTTGTTTCAGGTTTTTCATACCTTTATTGTGTCATTTAATGAA[C/T]AACGCCGGCCCGTGATGCCACTTTTAACAGCAATGAAGAGGACACCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 461 9778 13 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37640159)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37116971
GRCz11 13 37242861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTTTATCTGCTGAAGAGACAGAGCCAATGGATCATGCACGAGCAGCC[G/T]AGGAGGCCCGGGAGAAACTGGAGATATTGAAGGTTTGWCTTGCTTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 765 9778 19 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37635356)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37112168
GRCz11 13 37238058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGTAGAGGTGGTTTCTGGATCACTTCGTACCTACACTAAGAGACTA[C/T]AGGTACACAGTATTTGCATATACACCTAATTGCATTCATACACACATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 1010 9778 23 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37632201)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37109013
GRCz11 13 37234903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTATGATTGTTGTACAAGACTATGAAGCGGAGAAAGGTAGCCCACAAT[C/A]ACAAATACACCCCTGTGAGCAGGAAAAAGACTGTCAGTCCATTGAGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 1021 9778 23 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37632167)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37108979
GRCz11 13 37234869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGTAGCCCACAATCACAAATACACCCCTGTGAGCAGGAAAAAGACTG[T/A]CAGTCCATTGAGCTTAAGTCACAAAAAGTTGTCGAAGCTCAAGCAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 1362 9778 23 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37631146)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37107958
GRCz11 13 37233848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACCACAAAGATTTACAGTGGCCCAAGCAATGCCCCAAGGTATTTCC[A/T]GACCAGTCCAGCAGTACCCAACACCTCCCATGCAACCACAAATGATTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 1452 9778 23 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37630874)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37107686
GRCz11 13 37233576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGAAGTGCTCCACTTATGACTCAACCTGAAGGGCAACCACTGYGGTG[T/A]CCACCCMGAGATGCCACCCAAAATTAYCCYAAAATTCAAGGACCAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 1524 9778 23 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37630658)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37107470
GRCz11 13 37233360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACTGTTCCAGGTCAGGCAGTACAACCCCAACCTCAATTATCTGTTTA[T/A]CCTAAAACCCAGCCACAACCACAGCCTCAGCAATGGCTCTCTCCAAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 1877 9778 26 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37626985)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37103797
GRCz11 13 37229687
KASP Assay ID:
2260-6787.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTTTTTATTAACCAATAGTTCACAAACTGAGCAAGCAAAAGAGCCA[C/T]AAACTCAGAAAGCACCGACAATCCCACCACCTGTTGAGAAGCCCAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 1926 9778 27 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37626660)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37103472
GRCz11 13 37229362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGYGGAGAAGAGAGAGATAGTGAAACAAACGAGTACAGAAGAGGACAG[G/A]TATGGATTTAAAAAGAAAWCAGCTTTATATGTTACTATATTCAGTACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 1926 9778 27 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37626660)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37103472
GRCz11 13 37229362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGYGGAGAAGAGAGAGATAGTGAAACAAACGAGTACAGAAGAGGACAG[G/A]TATGGATTTAAAAAGAAAWCAGCTTTATATGTTACTATATTCAGTACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 1967 9778 None 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37626430)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37103242
GRCz11 13 37229132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATCAGTCACTCCTACAGACCTGCAGAAACGACTGAGAGAATTAAAGG[T/A]AATAGTTTTAAGTTAGTCATTTCAGAATAATACTTTAGAATAATGGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 2329 9778 33 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37619322)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37096134
GRCz11 13 37222024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCATGTTTTTGTGTATTTCACAGATTAGAACAATGCACTGTTCTCATG[G/T]AACTGCTGAAGAAGTTTCAGAACTGCCGCACTTACCTGACCAACACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 2783 9778 41 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37611451)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37088263
GRCz11 13 37214153
KASP Assay ID:
2260-6784.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACTGGCTTCAGCAGAGGGAACAAGTGCCAGAACAGAGAGAAAAACTA[C/T]GACAAATCCAAGAGGAGTTTCTTAAAGAAAGGTAACACTTGCTTTTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 2857 9778 42 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37609577)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37086389
GRCz11 13 37212279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACAAGACCCTTGATGCCCAGATTGAAACATTCCAAACTAATGCAGAA[C/T]AGATCAGAGCCTGGATCAGAGATTTAAAGCAAGGACTCGAACACTTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 2931 9778 43 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37609167)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37085979
GRCz11 13 37211869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGGAGGAGACCAGAAGACAAGAACTTGTTCACACACTTAAAAACATC[G/T]AGGATGAATGGAAAAGAGTTCTGGATTTGGCCCAACTCCTAAAACATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 3017 9778 44 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37608805)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37085617
GRCz11 13 37211507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTGCTGATGAAGCTGATTCCAGATTGGCCAGTTTACAGAGGCAAGGA[C/T]AGAGTTTATGTTCTTATAAAGAGCTTGACACTGAGAGGAGGAGTCACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 3216 9778 45 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37608068)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37084880
GRCz11 13 37210770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGCTAGGTGAAGATACTCAAATTCAGGAGAAAATGAATGGAGCTCAG[G/A]TATAGTAAGAGCCAAAGAGTGATATTCTAGTTCACTTACCAAATATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2693
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 3331 9778 46 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37607625)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37084437
GRCz11 13 37210327
KASP Assay ID:
554-2892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCATGGTACACAAGACCAGCTTGAAGAGAGACTAAGCAGAGCACAAG[T/G]AAGTATTAATATAGGCTCAGCAGTGGAAGTCATCACAGTTGGGTAAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 3496 9778 48 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37605655)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37082467
GRCz11 13 37208357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGGCCACTATGGAGGAGKKCATACCTGTCTTAATCAAAGAACTTACA[G/A]TAAGACATTTTTAGAGGAGTGCTGTGTTAATYATTTCTTACTAATTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 3786 9778 53 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
ENSDART00000075522 Nonsense 3786 9778 53 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37603919)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37080731
GRCz11 13 37206621
KASP Assay ID:
2260-6779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTAAAAGCCTACAGGTGGCACTGTCTCATAAAGAACTGCTGAGGGACTG[T/A]CTAGGCCCTGACTTGGCTGGAAAGCTTGAAAGAGATGGCCTAAAAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 3786 9778 53 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
ENSDART00000075522 Nonsense 3786 9778 53 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37603919)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37080731
GRCz11 13 37206621
KASP Assay ID:
2260-6779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTAAAAGCCTRCAGGTGGCACTGTCTCATAAAGAACTGCTGAGGGACTG[T/A]CTAGGCCCTGACTTGGCTGGAAAGCTTGAAAGAGATGGCCTAAAAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 3986 9778 55 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37603150)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37079962
GRCz11 13 37205852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCAGATAAAGAGATGCCCACTTCCTCATGCGCAGCTCCTGATAGCT[T/A]GGAAACCACAGTTCAAGACACAGACATTTGGAGCCGTGGAATTACAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 4335 9778 55 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37602104)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37078916
GRCz11 13 37204806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATAAAGAACGATTTATAGAAACTGATTCTAAACTTAAACCTTCAGTC[A/T]AACAACCAAATGAGGGAGAAACTGAGGTTCAAACAAACAAGGTGGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 4380 9778 55 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37601969)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37078781
GRCz11 13 37204671
KASP Assay ID:
2260-6777.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCATTGATGTCATTTTAGRAGCAGASACAATGGCTTCATCAGGTGGT[A/T]AAGCAAAATCCACAGTWATTGAACCTAAACTRACACCTCTGTTTCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 4451 9778 55 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37601755)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37078567
GRCz11 13 37204457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACTGATGCCTCCTGTCAAACGACAGGATAGTAAAACTGATGTCCAGT[C/A]AAACAAGATAAATGCATCAATGCAAGAGGAAAAAGCTGAAAATGAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Missense 6573 9778 68 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37581515)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37058327
GRCz11 13 37184217
KASP Assay ID:
554-4076.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATTGTGTATGTGTGATATACTGTACCTGCTGTAGGTGCGAGACTGGC[T/A]GCAGGAGCATGAKGACATGGTGAARGGCTCACAGAGCTGGATCTCAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 7162 9778 79 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37555972)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37032784
GRCz11 13 37158674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGTGACGGTCCAGTTACAGCTGCAGGACAGACACAGCAACCATCAGG[T/C]ACACACGCACACTCTAATGCACAAAAYTTACTTCGCTTGCAAGAGMAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 7369 9778 85 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37547071)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37023883
GRCz11 13 37149773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTATTCATTCATTTATTCATACATTACTCTGGTTTTCTTTGAATTTC[A/G]GAGTTTATCTGTAGAGCTGATCTCCTTAGAGTCCACATTGAGCTCTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 7523 9778 88 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37543607)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37020419
GRCz11 13 37146309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGACACTTTGTGTAGGAGGTGTTGGAGAGTGTTTGGAGTGATCTAGAG[C/T]AGCGCTGTGGAGCTCTGCAGTGGACACTTGATCAGCAGCAGATGAGCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 8345 9778 101 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37533742)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37010554
GRCz11 13 37136444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATCTTATTGTCTTTGTTTAGGTGTTACAGAAAGGCTCAGAGATGCTA[C/T]AGACTGATGTGAATGAAATGCTTGAAGCCTCTAAAGATGTGATTGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 8386 9778 101 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510   None 1153 None 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37533619)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37010431
GRCz11 13 37136321
KASP Assay ID:
554-4614.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCCGATCTGAATGCCGTTTGATCACACGTGGTTACCTGCARTTAAAA[C/T]AGACTCTTACAGGACGAATTGAACACATGCAGGTAAGACTCAAATGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 9050 9778 114 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510 Nonsense 397 1153 8 22
ENSDART00000135935   None 207 None 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884   None 252 None 5
Genomic Location (Zv9):
Chromosome 13 (position 37503082)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36979894
GRCz11 13 37105784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGCCTAWGGTGCAAGTTCCTGGACGATTATGCWCGTTTTGAAGAGTG[G/A]CTGAACACAGCAGAAAGAACAGCTGCCAACCCCGCCACCAAAGATGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 9301 9778 118 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510 Nonsense 648 1153 12 22
ENSDART00000135935 Nonsense 64 207 2 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884 Nonsense 33 252 1 5
Genomic Location (Zv9):
Chromosome 13 (position 37499725)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36976537
GRCz11 13 37102427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGCCATGGGCTGTGATGTGTCGTTAACTGTACGTCAGGCTGTTTCA[C/T]AGCTATTACCGCCTGCTTTGGAGCGCTCAGGCCGTGAGACGCCTGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Nonsense 9396 9778 120 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510 Nonsense 766 1153 15 22
ENSDART00000135935 Nonsense 159 207 4 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884 Nonsense 128 252 3 5
Genomic Location (Zv9):
Chromosome 13 (position 37490962)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36967774
GRCz11 13 37093664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTACTCCACACAGACAGTATAATGTTGTACTTTGTCTCTCCAGGAT[A/T]AACTGATGTCCGAGTGTGCGGGCAGTATAGACAGTATAAAGCGAGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075522 Essential Splice Site 9436 9778 120 127
ENSDART00000133242   None 273 None 5
ENSDART00000135510 Essential Splice Site 806 1153 15 22
ENSDART00000135935 Essential Splice Site 199 207 4 5
ENSDART00000136750   None 168 None 4
ENSDART00000139734   None 281 None 7
ENSDART00000147884 Essential Splice Site 168 252 3 5
Genomic Location (Zv9):
Chromosome 13 (position 37490840)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36967652
GRCz11 13 37093542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTGGAGGATCAGGGTCTGACGGGCTTCAGTGCAGCAGATAAYACAGG[T/C]ACTGCTGATTACATCAAGCACACNNNNNNNCACANNNNNNNNNNNGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link