zgc:113054

Ensembl ID:
ENSDARG00000053483
ZFIN ID:
ZDB-GENE-050320-9
Description:
hypothetical protein LOC541322 [Source:RefSeq peptide;Acc:NP_001013468]
Human Orthologue:
BDH2
Human Description:
3-hydroxybutyrate dehydrogenase, type 2 [Source:HGNC Symbol;Acc:32389]
Mouse Orthologue:
Bdh2
Mouse Description:
3-hydroxybutyrate dehydrogenase, type 2 Gene [Source:MGI Symbol;Acc:MGI:1917022]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33943 Nonsense Mutation detected in F1 DNA During 2018
sa38575 Nonsense Mutation detected in F1 DNA During 2018
sa40773 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075521 Nonsense 103 551 4 11
Genomic Location (Zv9):
Chromosome 6 (position 43386991)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43458155
GRCz11 6 43455691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAAACTGAACTTTAAGACCATTTATTTTTATTCCATAGGTCAAGTAT[T/A]GAAGATGCTGGTGCATATGAGCAAAGCAAAGAGGGTCTTAGAGATAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075521 Nonsense 253 551 5 11
Genomic Location (Zv9):
Chromosome 6 (position 43387511)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43458675
GRCz11 6 43456211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGGAAAAGCATTGCGGGATTTTAATCAGTTTGTCACAGCTGATCCT[C/T]GAGTAGAGCAGGTGATAAACCTGTTTTCTCAATGCAACAAAATGAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075521 Nonsense 269 551 6 11
Genomic Location (Zv9):
Chromosome 6 (position 43387651)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 43458815
GRCz11 6 43456351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCGTTTTATAGGTCATCATCCCTCTGAGAGATGGACTCACTATAATA[C/T]GAAGAGTGCCCTATACACCTCAGCCAAACTCACAGGTGACGATACATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link