zgc:113056

Ensembl ID:
ENSDARG00000053474
ZFIN ID:
ZDB-GENE-050327-81
Description:
tudor and KH domain-containing protein [Source:RefSeq peptide;Acc:NP_001014377]
Human Orthologue:
TDRKH
Human Description:
tudor and KH domain containing [Source:HGNC Symbol;Acc:11713]
Mouse Orthologue:
Tdrkh
Mouse Description:
tudor and KH domain containing protein Gene [Source:MGI Symbol;Acc:MGI:1919884]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42071 Nonsense Mutation detected in F1 DNA During 2018
sa16677 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009794 Nonsense 39 573 3 15
ENSDART00000075511   None 460 3 16
ENSDART00000136617 Nonsense 7 211 2 6
ENSDART00000142329   None 445 None 7
Genomic Location (Zv9):
Chromosome 12 (position 35074030)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33478139
GRCz11 12 33579122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGAGTTTACCGGTTACTCCCACCCAAGTGATGGCTGCGGTGCAGGAT[G/T]GACCATGGAAGAGCCTGAGCTCTGGAAAGAAAGTGGCGTTGGCTGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009794 Essential Splice Site 75 573 None 15
ENSDART00000075511 Essential Splice Site None 460 None 16
ENSDART00000136617 Essential Splice Site 43 211 None 6
ENSDART00000142329   None 445 None 7
Genomic Location (Zv9):
Chromosome 12 (position 35073920)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33478029
GRCz11 12 33579012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCAACAGTTGGATACCTTRTTTATCGTCACATTCGAAACAGCASTGG[T/A]GAGTTTTAACGTTTAATKGCTTTTTAATAACAGCCCTGCTATAAACTTYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link