si:dkey-76b14.5

Ensembl ID:
ENSDARG00000053462
ZFIN ID:
ZDB-GENE-090311-30
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JKW3]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12561 Nonsense Available for shipment Available now
sa12520 Nonsense Available for shipment Available now
sa12380 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058210   None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
ENSDART00000058210   None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
Genomic Location (Zv9):
Chromosome 1 (position 56666208)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55450141
GRCz11 1 56119437
KASP Assay ID:
2259-1266.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACWTCCTCAAATATTTTCTTTTGTCAGGTATTTGTTTGGTAATAAGGTG[C/T]GAGGAAGTGCATTTGTGGTGTTTGGRTTGGTGGAYGGTGAGAAGAAGATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058210   None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
ENSDART00000058210   None 204 None 5
ENSDART00000133079 Nonsense 249 628 7 14
Genomic Location (Zv9):
Chromosome 1 (position 56666208)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55450141
GRCz11 1 56119437
KASP Assay ID:
2259-1266.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACWTCCTCAAATATTTTCTTTTGTCAGGTATTTGTTTGGTAATAAGGTG[C/T]GAGGAAGTGCATTTGTGGTGTTTGGRTTGGTGGAYGGTGAGAAGAAGATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058210 Nonsense 203 204 5 5
ENSDART00000133079 Nonsense 469 628 11 14
Genomic Location (Zv9):
Chromosome 1 (position 56664010)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55447943
GRCz11 1 56117239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAMCTGAATCTGGGAAATGGTGCTGGAGTGGTGAACCAGGATTTCACATA[T/A]ATGGTGAGTAACGCATGACACCATTCAGGGCCAGAGTGGGACTCCTTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link