zgc:172295

Ensembl ID:
ENSDARG00000053456
ZFIN ID:
ZDB-GENE-080204-72
Description:
glycerol kinase [Source:RefSeq peptide;Acc:NP_001108056]
Human Orthologues:
GK, GK2
Human Descriptions:
glycerol kinase 2 [Source:HGNC Symbol;Acc:4291]
glycerol kinase [Source:HGNC Symbol;Acc:4289]
Mouse Orthologues:
Gk2, Gyk, Gykl1
Mouse Descriptions:
glycerol kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1329027]
glycerol kinase Gene [Source:MGI Symbol;Acc:MGI:106594]
glycerol kinase-like 1 Gene [Source:MGI Symbol;Acc:MGI:891990]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9157 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075470 Nonsense 440 530 16 19
Genomic Location (Zv9):
Chromosome 1 (position 27680697)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27946445
GRCz11 1 28749797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCCAGGTTGATGGAGGCATGACATCCAACCGATTACTGATGCAGCTG[C/T]AAGCTGACATACTGTGTATCCCAGTCGGTAAAATGCCCTTTTTTTAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link