sord

Ensembl ID:
ENSDARG00000053405
ZFIN ID:
ZDB-GENE-040426-1231
Description:
sorbitol dehydrogenase [Source:RefSeq peptide;Acc:NP_001165890]
Human Orthologue:
SORD
Human Description:
sorbitol dehydrogenase [Source:HGNC Symbol;Acc:11184]
Mouse Orthologue:
Sord
Mouse Description:
sorbitol dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:98266]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40923 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1364 Essential Splice Site Available for shipment Available now
sa26975 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075421 Essential Splice Site 30 354 2 9
Genomic Location (Zv9):
Chromosome 7 (position 32260243)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30654583
GRCz11 7 30925733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTTTTGTATAGGAACAGCGTCCGATTCCGGAGCCAGGACCAAATGG[T/A]ATTTATGTCACAAAGAAATATTACCGAATGCATTGCAATAAAAGGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075421 Essential Splice Site 259 354 7 9
Genomic Location (Zv9):
Chromosome 7 (position 32258495)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30652835
GRCz11 7 30923985
KASP Assay ID:
554-1276.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTATAGAGTGCACCGGAGTGCAGAGCAGCATTCAGACAGCCATCTAT[G/A]TTGGTTTATTTACTTTATGAAATCATACTGGCTTCACTGTACCTTGATGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa26975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075421 Essential Splice Site 300 354 8 9
Genomic Location (Zv9):
Chromosome 7 (position 32258281)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30652621
GRCz11 7 30923771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGTCAGAGAAGTTGACATCAGAGGTGTATTTCGCTACTGCAATAC[G/A]TGAGTAGAATTACTGTCAACATCAGTTTATTACAATATGTATATTTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link