zgc:123251

Ensembl ID:
ENSDARG00000053386
ZFIN ID:
ZDB-GENE-051120-93
Description:
Novel protein (Zgc:123251) [Source:UniProtKB/TrEMBL;Acc:B8JJR0]
Human Orthologue:
WDR27
Human Description:
WD repeat domain 27 [Source:HGNC Symbol;Acc:21248]
Mouse Orthologue:
Wdr27
Mouse Description:
WD repeat domain 27 Gene [Source:MGI Symbol;Acc:MGI:1918932]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42249 Nonsense Mutation detected in F1 DNA During 2018
sa35546 Nonsense Mutation detected in F1 DNA During 2018
sa35547 Nonsense Available for shipment Available now
sa38958 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14036 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075414 Nonsense 29 450 2 13
ENSDART00000112947   None 255 None 10
Genomic Location (Zv9):
Chromosome 13 (position 35750627)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35403203
GRCz11 13 35529035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTCTCTGTAACCTGCAGTAAGCCGGTTTCCCATCTTCAGTTGGCGTG[C/A]TGTCCTTCTCATTGTGCCATCCCATGGAAGGACAAGAATATTAGGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075414 Nonsense 225 450 8 13
ENSDART00000112947   None 255 None 10
Genomic Location (Zv9):
Chromosome 13 (position 35754251)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35406827
GRCz11 13 35532659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTACAGCACCTGTGTTAACTGAATTTTCATTGTGATTCAAGCTTT[G/A]GTGCTACACTCTCCCTGTGGACCACAAATGTCGCTTGGTGACAAAACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075414 Nonsense 235 450 8 13
ENSDART00000112947   None 255 None 10
Genomic Location (Zv9):
Chromosome 13 (position 35754282)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35406858
GRCz11 13 35532690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTGTGATTCAAGCTTTGGTGCTACACTCTCCCTGTGGACCACAAATG[T/A]CGCTTGGTGACAAAACTGGACCTTTCAAAACTTGAACAAAAGCATGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075414 Essential Splice Site 265 450 8 13
ENSDART00000112947   None 255 None 10
Genomic Location (Zv9):
Chromosome 13 (position 35754374)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35406950
GRCz11 13 35532782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGAGAGAAACCTCCGGATGATCAGCCCTCCTCAAAGTAGAACAGATG[G/A]TTAGTAAAACCATAAGCCACATTTCAGACTACATATGACTACTGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075414 Essential Splice Site 349 450 11 13
ENSDART00000112947 Essential Splice Site 62 255 3 10
Genomic Location (Zv9):
Chromosome 13 (position 35758989)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35411565
GRCz11 13 35537397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWTTTCCATAGCAGGCTCATGGGTGATCTCTGAAGGRCTKGATGGCAGCG[T/C]AAGTCAAATTCTGATAAYTGAAATTGAATACAAATTTTGTGTTTGCACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link