
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eif3jb
- Ensembl ID:
- ENSDARG00000053370
- ZFIN ID:
- ZDB-GENE-040426-2900
- Description:
- Eukaryotic translation initiation factor 3 subunit J-B [Source:UniProtKB/Swiss-Prot;Acc:Q803P1]
- Human Orthologue:
- EIF3J
- Human Description:
- eukaryotic translation initiation factor 3, subunit J [Source:HGNC Symbol;Acc:3270]
- Mouse Orthologues:
- Eif3j, Gm9781
- Mouse Descriptions:
- eukaryotic translation initiation factor 3, subunit J Gene [Source:MGI Symbol;Acc:MGI:1925905]
- predicted gene 9781 Gene [Source:MGI Symbol;Acc:MGI:3704486]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40927 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38619 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40927
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075400 | Essential Splice Site | 130 | 264 | None | 8 |
The following transcripts of ENSDARG00000053370 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 32763256)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 31157596 GRCz11 7 31428746 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATATATATATATATGTATAAAGTTAATCGATGAATTTCTTCCCGTCTTT[A/G]GGTGTGGATCCTGCTGCTGCAAATGCCTCAACTACTGTTAACACAACAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38619
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075400 | Nonsense | 260 | 264 | 8 | 8 |
The following transcripts of ENSDARG00000053370 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 32765684)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 31160024 GRCz11 7 31431174 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGACTTTGCTGACTATGGTGGTTTTGACGGTGGTTACGGCAATGAATA[T/A]GATGACTTCATGTGACAAAGGATCATCGTTCCCCTTCCCATTCCCTCTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: