zgc:112285

Ensembl ID:
ENSDARG00000053323
ZFIN ID:
ZDB-GENE-050913-132
Description:
hypothetical protein LOC561476 [Source:RefSeq peptide;Acc:NP_001020685]
Human Orthologue:
CELA1
Human Description:
chymotrypsin-like elastase family, member 1 [Source:HGNC Symbol;Acc:3308]
Mouse Orthologue:
Cela1
Mouse Description:
chymotrypsin-like elastase family, member 1 Gene [Source:MGI Symbol;Acc:MGI:95314]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22152 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075351 Essential Splice Site 41 316 2 6
Genomic Location (Zv9):
Chromosome 12 (position 36269508)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34952917
GRCz11 12 35053980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTTTGTGGCACTTTAACTGACATTGACTCAAGTGTTGTTCTGTCCTT[A/C]GACTGGCCGAAGGACTGTGGCCTGGCTCATTTCAAACCAAACACAGTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link