slc2a15b

Ensembl ID:
ENSDARG00000053269
ZFIN ID:
ZDB-GENE-050508-1
Description:
solute carrier family 2 (facilitated glucose transporter), member 15b [Source:RefSeq peptide;Acc:NP
Human Orthologue:
SLC2A9
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 9 [Source:HGNC Symbol;Acc:13446]
Mouse Orthologue:
Slc2a9
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 9 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19521 Essential Splice Site Available for shipment Available now
sa38272 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075286 Essential Splice Site 143 522 5 12
Genomic Location (Zv9):
Chromosome 1 (position 31037348)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30850808
GRCz11 1 31583376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTGTGAATTAAGTCCCTGTACTGACACTCATGTGCTGTGCTAATGT[A/G]GGAATAGCTCTCAGTGTGGTGCCCATGTATCTGGGAGAAATTGCCCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075286 Nonsense 368 522 9 12
Genomic Location (Zv9):
Chromosome 1 (position 31048714)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30862174
GRCz11 1 31594742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACTTTCATGGGTCTGTGCTGTGCTGGAATCACCTTCTCTCTCTTAT[T/A]AGAGGTAATTAAACCACAGACACTCATACTAATGCTGAATGTACAATAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alzheimer's disease: Genome-wide association study of Alzheimer's disease with psychotic symptoms. (View Study)
  • Biochemical measures: Genome-wide association study of biochemical traits in Korcula Island, Croatia. (View Study)
  • Metabolic traits: Human metabolic individuality in biomedical and pharmaceutical research. (View Study)
  • Renal function-related traits (urea): Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations. (View Study)
  • Urate levels: Association of three genetic loci with uric acid concentration and risk of gout: a genome-wide association study. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
  • Urate levels: Genome-wide association study identifies genes for biomarkers of cardiovascular disease: serum urate and dyslipidemia. (View Study)
  • Urate levels: Multiple genetic loci influence serum urate levels and their relationship with gout and cardiovascular disease risk factors. (View Study)
  • Urate levels: SLC2A9 influences uric acid concentrations with pronounced sex-specific effects. (View Study)
  • Urate levels: SLC2A9 is a newly identified urate transporter influencing serum urate concentration, urate excretion and gout. (View Study)
  • Uric acid levels: A genome wide association study of plasma uric acid levels in obese cases and never-overweight controls. (View Study)
  • Uric acid levels: A genome-wide association study of serum uric acid in African Americans. (View Study)
  • Uric acid levels: Genome-wide association of serum uric acid concentration: replication of sequence variants in an island population of the Adriatic coast of Croatia. (View Study)
  • Uric acid levels: Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link