zgc:113372

Ensembl ID:
ENSDARG00000053263
ZFIN ID:
ZDB-GENE-050913-150
Description:
hypothetical protein LOC569258 [Source:RefSeq peptide;Acc:NP_001025405]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075281 Nonsense 162 188 5 5
ENSDART00000123641 Nonsense 86 112 1 2
Genomic Location (Zv9):
Chromosome 17 (position 50156094)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49542019
GRCz11 17 49641924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTAAAATGTCATGAGAGGATTCACACTGGAGAGAAACCCTACMGAWGT[C/T]AGCAGTGTCTGAAGCGTTTCACACAGCTGTCACAACTTMAGAAACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link