
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113372
- Ensembl ID:
- ENSDARG00000053263
- ZFIN ID:
- ZDB-GENE-050913-150
- Description:
- hypothetical protein LOC569258 [Source:RefSeq peptide;Acc:NP_001025405]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12211 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12211
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075281 | Nonsense | 162 | 188 | 5 | 5 |
ENSDART00000123641 | Nonsense | 86 | 112 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 17 (position 50156094)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 49542019 GRCz11 17 49641924 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCTAAAATGTCATGAGAGGATTCACACTGGAGAGAAACCCTACMGAWGT[C/T]AGCAGTGTCTGAAGCGTTTCACACAGCTGTCACAACTTMAGAAACACACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: