atp1b4

Ensembl ID:
ENSDARG00000053262
ZFIN ID:
ZDB-GENE-070412-1
Human Orthologue:
ATP1B4
Human Description:
ATPase, Na+/K+ transporting, beta 4 polypeptide [Source:HGNC Symbol;Acc:808]
Mouse Orthologue:
Atp1b4
Mouse Description:
ATPase, (Na+)/K+ transporting, beta 4 polypeptide Gene [Source:MGI Symbol;Acc:MGI:1915071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35720 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075278 Essential Splice Site 139 347 3 8

The following transcripts of ENSDARG00000053262 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34437145)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33121845
GRCz11 14 33462159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAATAAGTCCATACGCTCCCACCTACAATGACAGAGTGATGCCGCCAG[G/C]TTGGAAAATCAGCATTTTACTTTGTGTGTTTAGATGGAAAAATGATTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link