zgc:113090

Ensembl ID:
ENSDARG00000053260
ZFIN ID:
ZDB-GENE-050522-532
Description:
hypothetical protein LOC553741 [Source:RefSeq peptide;Acc:NP_001018548]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18220 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075277 Essential Splice Site 59 343 2 3
Genomic Location (Zv9):
Chromosome 3 (position 33008732)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32740042
GRCz11 3 32871756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCAGCTGAAGCTCCGAGAACTCCARGAGAGAAACACTAAAGCACCAG[G/T]TCAGAGATTTGTATTATMATTTATTATTTGCCWGTTCATCCTTCTATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link