wu:fj82b07

Ensembl ID:
ENSDARG00000053246
ZFIN ID:
ZDB-GENE-030131-9492
Description:
Wu:fj82b07 protein [Source:UniProtKB/TrEMBL;Acc:Q5EB18]
Human Orthologue:
DEPDC7
Human Description:
DEP domain containing 7 [Source:HGNC Symbol;Acc:29899]
Mouse Orthologue:
Depdc7
Mouse Description:
DEP domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2139258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24599 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067517 Nonsense 91 545 2 9
Genomic Location (Zv9):
Chromosome 25 (position 6340385)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5846944
GRCz11 25 5974346
KASP Assay ID:
2261-9330.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGCTGTGAAGCGGTGGATGTTTTGCAGGATTATCTCACTCAAAAT[A/T]AGGTTTTTAGAGATGTTTTGGTTTCCAGAGCCTTGGCTGTGCGTCTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link