
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
itgb1b.1
- Ensembl ID:
- ENSDARG00000053232
- ZFIN ID:
- ZDB-GENE-060803-3
- Description:
- integrin, beta 1b.1 [Source:RefSeq peptide;Acc:NP_001030151]
- Human Orthologue:
- ITGB1
- Human Description:
- integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) [Source
- Mouse Orthologue:
- Itgb1
- Mouse Description:
- integrin beta 1 (fibronectin receptor beta) Gene [Source:MGI Symbol;Acc:MGI:96610]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39917 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39917
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075234 | Essential Splice Site | 370 | 787 | 9 | 15 |
- Genomic Location (Zv9):
- Chromosome 2 (position 43696271)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 43745735 GRCz11 2 43627322 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGATATTTGCCCAGCACTAATATGCTCTTTGTGTTTAATTCCGTGCATTA[G/A]TCTCTGTCCTCTGAGGTGATTCTGGAGAACAGCAAGCTACCTGATGGTGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Depression (quantitative trait): Genome-wide association scan of trait depression. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: