zgc:66156

Ensembl ID:
ENSDARG00000053207
ZFIN IDs:
ZDB-GENE-040426-1554, ZDB-GENE-040426-1554
Description:
Zgc:66156 protein [Source:UniProtKB/TrEMBL;Acc:Q7SXN9]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25169 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123920 Splice Site, Nonsense 1509 1621 33 35
ENSDART00000130036   None 555 None 17
Genomic Location (Zv9):
Chromosome 22 (position 337934)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 240168
GRCz11 22 228413
KASP Assay ID:
554-7651.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCTGGACCAGCTTGAGACCCTGAAGAGGGAGAACAAGAATCTGCAA[C/T]GTAAACGCCACTTTTATTTACAGAAAGAATTTAATAAGCAACAGTTTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link