zgc:153718

Ensembl ID:
ENSDARG00000053204
ZFIN ID:
ZDB-GENE-060825-154
Description:
sorting nexin 22-like [Source:RefSeq peptide;Acc:NP_001038839]
Human Orthologue:
SNX22
Human Description:
sorting nexin 22 [Source:HGNC Symbol;Acc:16315]
Mouse Orthologue:
Snx22
Mouse Description:
sorting nexin 22 Gene [Source:MGI Symbol;Acc:MGI:2685966]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37996 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075197 Essential Splice Site 125 220 3 6
ENSDART00000085507 Essential Splice Site 203 298 3 6
ENSDART00000136054 Essential Splice Site 125 127 3 4
Genomic Location (Zv9):
Chromosome 25 (position 6321009)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5866320
GRCz11 25 5993722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGGTCAAACATTTTCATCCAACAAGCAAGAACTGCAGCTCTGAG[T/C]ATGTTTACAACCATTAGTAATCATTTGATAATTAATAAATAGTTATATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link