zgc:172323

Ensembl ID:
ENSDARG00000053201
ZFIN ID:
ZDB-GENE-080204-113
Description:
hypothetical protein LOC564165 [Source:RefSeq peptide;Acc:NP_001107899]
Human Orthologues:
NES, SYNM
Human Descriptions:
nestin [Source:HGNC Symbol;Acc:7756]
synemin, intermediate filament protein [Source:HGNC Symbol;Acc:24466]
Mouse Orthologues:
Nes, Synm
Mouse Descriptions:
nestin Gene [Source:MGI Symbol;Acc:MGI:101784]
synemin, intermediate filament protein Gene [Source:MGI Symbol;Acc:MGI:2661187]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18553 Essential Splice Site Available for shipment Available now
sa22891 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075191 Essential Splice Site 293 847 6 11
Genomic Location (Zv9):
Chromosome 16 (position 35054651)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32786151
GRCz11 16 32740181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGCAGATCCAACACCAGTATGATGACATTGCCGCTAAAAACTTACAG[G/T]TATTTATTTTAACATGATAGCATTATCAGCAAYATGGGGAGCTTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075191 Nonsense 568 847 10 11
Genomic Location (Zv9):
Chromosome 16 (position 35056142)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32787642
GRCz11 16 32741672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCCAAAGGGCTTCCGGGAGGTGTGGGTGGTGGTCCTGCCACAGGTCTT[G/T]GAGGAGGTGTAGGTGGTGATCCCGCCAAAGGGCTTCCGGGAGGTGTAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link