zgc:110626

Ensembl ID:
ENSDARG00000053159
ZFIN ID:
ZDB-GENE-050417-447
Description:
hypothetical protein LOC550588 [Source:RefSeq peptide;Acc:NP_001017889]
Human Orthologues:
ARRDC2, ARRDC3, ARRDC4, TXNIP
Human Descriptions:
arrestin domain containing 2 [Source:HGNC Symbol;Acc:25225]
arrestin domain containing 3 [Source:HGNC Symbol;Acc:29263]
arrestin domain containing 4 [Source:HGNC Symbol;Acc:28087]
thioredoxin interacting protein [Source:HGNC Symbol;Acc:16952]
Mouse Orthologues:
Arrdc2, Arrdc3, Arrdc4, Txnip
Mouse Descriptions:
arrestin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918057]
arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]
arrestin domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913662]
thioredoxin interacting protein Gene [Source:MGI Symbol;Acc:MGI:1889549]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44616 Nonsense Mutation detected in F1 DNA During 2018
sa11420 Essential Splice Site Available for shipment Available now
sa7000 Nonsense Mutation detected in F1 DNA During 2018
sa7001 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045598 Nonsense 67 454 1 7
Genomic Location (Zv9):
Chromosome 5 (position 47888983)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45677723
GRCz11 5 46277876
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCAAATGTTTGCTGGTCAGAGCGACACGGTAAAACCACTGTTCTTTA[T/A]TCGGATAAAGAGAAGTTTTATTCGGTGGAGAGGTTTTTCGTTCAGACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045598 Essential Splice Site 88 454 1 7
Genomic Location (Zv9):
Chromosome 5 (position 47889046)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45677786
GRCz11 5 46277939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTTTATTCGGTGGAGAGGTTTTTCGTTCAGACCGACACAAAACATGG[T/G]AGGTGTCTGCTCGACTACTTTAGTTTTTGCAACNNATGAAGCCGAGTCGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045598 Nonsense 236 454 6 7
Genomic Location (Zv9):
Chromosome 5 (position 47891773)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45680513
GRCz11 5 46280666
KASP Assay ID:
554-5239.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCAGTCAAGCYAAAGTACTGCCTGTATGAAAAACACAGTTTTTTTGCC[A/T]GAGGAAAGMGAAAACTTCACACKCACGACATTTTTAAAGAARTGGGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045598 Nonsense 441 454 7 7
Genomic Location (Zv9):
Chromosome 5 (position 47896244)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45684984
GRCz11 5 46285137
KASP Assay ID:
554-5201.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTTCCACTTCAGTCAAGCACATCAGCTCCACCTCCATATCAGGAATA[C/A]AAGTTTTATCCACARCTGCCAGATCAGCCAGAAAAATCTTGACAAAATCW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer (prognosis): Identification of inherited genetic variations influencing prognosis in early-onset breast cancer. (View Study)
  • Neuroticism: A genome-wide association study of neuroticism in a population-based sample. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link