zgc:123165

Ensembl ID:
ENSDARG00000053152
ZFIN ID:
ZDB-GENE-030131-5387
Description:
protein-L-isoaspartate O-methyltransferase domain-containing protein 1 [Source:RefSeq peptide;Acc:N
Human Orthologue:
PCMTD1
Human Description:
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Pcmtd1
Mouse Description:
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 Gene [Source:MGI Symbol

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24537 Essential Splice Site Available for shipment Available now
sa14741 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075142 Essential Splice Site 236 359 6 7
Genomic Location (Zv9):
Chromosome 24 (position 36708689)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35327604
GRCz11 24 35213869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGCAGAACAGGACAGACAGCAACAAGTCTGAAGCCGTGGTGCTCCG[T/C]GAGTCTGATAAATCTCTACTCAAACCCTTAATACACGTGTTTAAAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075142 Nonsense 290 359 7 7
Genomic Location (Zv9):
Chromosome 24 (position 36711385)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35330300
GRCz11 24 35216565
KASP Assay ID:
2261-8959.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGCGCAAGCGCAGACGCTGTCGYCGCCGCCGCCGCATCAACACATA[T/A]GTGTTYGTGGGCAACCAGCTGATCCCGCAGCCCCTCGACAGCGAAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link