zgc:113352

Ensembl ID:
ENSDARG00000053119
ZFIN ID:
ZDB-GENE-050327-61
Description:
acid sphingomyelinase-like phosphodiesterase 3a [Source:RefSeq peptide;Acc:NP_001014360]
Human Orthologue:
SMPDL3A
Human Description:
sphingomyelin phosphodiesterase, acid-like 3A [Source:HGNC Symbol;Acc:17389]
Mouse Orthologue:
Smpdl3a
Mouse Description:
sphingomyelin phosphodiesterase, acid-like 3A Gene [Source:MGI Symbol;Acc:MGI:1931437]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43509 Nonsense Mutation detected in F1 DNA During 2018
sa14891 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075096 Nonsense 268 441 6 10
ENSDART00000144768 Nonsense 235 411 5 7
Genomic Location (Zv9):
Chromosome 20 (position 40391953)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40463112
GRCz11 20 40360222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTACCCTTTGCTAAAAATACGACAGCCATGCGAGAAAACTACAATGAA[C/T]AACTGGTCAAAATATTTCGCAACTACAGTGAGGTGGTGGAGGGTCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075096 Nonsense 348 441 8 10
ENSDART00000144768 Nonsense 315 411 7 7
Genomic Location (Zv9):
Chromosome 20 (position 40388152)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 40459311
GRCz11 20 40356421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTCTTTCTTTTTTTCTTCTTCCTCCAWAGGATATTTGGCAGTTCTA[T/A]CTAAATCTCACTGAAGCAAACCWGGWGCAAAGGTCMGRGTGGAAGCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link