si:dkey-78p20.2

Ensembl ID:
ENSDARG00000053113
ZFIN ID:
ZDB-GENE-050309-166
Description:
Si:dkey-78p20.2 protein [Source:UniProtKB/TrEMBL;Acc:Q58EG8]
Human Orthologue:
PLA2R1
Human Description:
phospholipase A2 receptor 1, 180kDa [Source:HGNC Symbol;Acc:9042]
Mouse Orthologue:
Pla2r1
Mouse Description:
phospholipase A2 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:102468]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38827 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17385 Nonsense Available for shipment Available now
sa35033 Nonsense Mutation detected in F1 DNA During 2018
sa6194 Nonsense Mutation detected in F1 DNA During 2018
sa41788 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Essential Splice Site 153 1726 2 35
ENSDART00000148030   None 1406 None 30
Genomic Location (Zv9):
Chromosome 11 (position 11248109)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11143411
GRCz11 11 11127032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAAAAGAGAAGGGAGCACGGATAACATCTGTCAGCGGACGTATCGAA[G/A]TATGATTTTACTATTTTACTACCATTTGGGAATAATTATGATTTTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 199 1726 3 35
ENSDART00000148030   None 1406 None 30
Genomic Location (Zv9):
Chromosome 11 (position 11262826)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11158128
GRCz11 11 11141749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCCACYGATGAAAATACACTGGAGTGGTGCTCTACTACTGCAAACTA[T/A]GATCAAGAGCAGAARTGGGGGAATTGTCTRAAAWATGGTGAGGTTTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 229 1726 4 35
ENSDART00000148030   None 1406 None 30
Genomic Location (Zv9):
Chromosome 11 (position 11265661)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11160963
GRCz11 11 11144584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGATGTTCTTCTTTATGGGAGAAAGAACCTGTGACTGGACGCTGCTA[T/A]CAGGTGGTGTCCACAGCTGTGGTGACCTGGCATGAGGCGCGGGACGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 481 1726 9 35
ENSDART00000148030 Nonsense 161 1406 4 30
Genomic Location (Zv9):
Chromosome 11 (position 11276551)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11171554
GRCz11 11 11155175
KASP Assay ID:
554-4364.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGCATCATACGTGGTCTGTKTCTGACTGTGATAAGCCACGGGCTTA[T/A]ATGTGTATGAGGAACTCGCAGAATGTGAATGAAAGTGCAGCAGAGGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026135 Nonsense 1319 1726 29 35
ENSDART00000148030 Nonsense 999 1406 24 30
Genomic Location (Zv9):
Chromosome 11 (position 11303269)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11198272
GRCz11 11 11181893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATATAGCTGCTAATTTTTGCCCTGTATGATCTCTTTTGTATAGATGAG[C/T]AGCTGAAATGGCTGGATGGCACTTATGTGCAGTTCTCCAACTGGAAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link