zgc:153894

Ensembl ID:
ENSDARG00000053106
ZFIN IDs:
ZDB-GENE-060929-392, ZDB-GENE-060929-392
Description:
HBV PreS1-transactivated protein 3 [Source:RefSeq peptide;Acc:NP_001070204]
Human Orthologue:
KIAA1712
Human Description:
KIAA1712 [Source:HGNC Symbol;Acc:29356]
Mouse Orthologue:
BC088983
Mouse Description:
cDNA sequence BC088983 Gene [Source:MGI Symbol;Acc:MGI:3525111]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1971 Essential Splice Site Available for shipment Available now
sa12232 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075086 Essential Splice Site None 211 1 11
ENSDART00000127635   None 284 None 6
Genomic Location (Zv9):
Chromosome 1 (position 38771818)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37643274
GRCz11 1 38362452
KASP Assay ID:
554-2597.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAAGGAAGGGATTAGCAATAACTCCGTTACTAATATTTAGCCTTCGG[T/C]AAGAGTTTTGGTTTTCCAAACGTTAATATAACAACCGTTTTTAATGATTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075086 Nonsense 9 211 2 11
ENSDART00000127635 Nonsense 9 284 1 6
Genomic Location (Zv9):
Chromosome 1 (position 38772005)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37643461
GRCz11 1 38362639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACTCTTGATGAAATGACAGAGATGGCCACTGGTGACCTGAAGGGATG[T/A]CTCAGAAAACTGGAAGCGTCTCTTCGGTCTCTGAAGTATCCCAGAGATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link