zgc:113068

Ensembl ID:
ENSDARG00000053082
ZFIN ID:
ZDB-GENE-050320-49
Description:
hypothetical protein LOC541356 [Source:RefSeq peptide;Acc:NP_001013501]
Human Orthologue:
THADA
Human Description:
thyroid adenoma associated [Source:HGNC Symbol;Acc:19217]
Mouse Orthologue:
Thada
Mouse Description:
thyroid adenoma associated Gene [Source:MGI Symbol;Acc:MGI:3039623]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31907 Essential Splice Site Available for shipment Available now
sa24927 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075054 Essential Splice Site None 364 1 10
ENSDART00000143705   None 959 None 17
ENSDART00000147371   None 636 None 9

The following transcripts of ENSDARG00000053082 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8258347)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8560867
GRCz11 13 8892890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCTACACGCAGTATTGAACTTTTTTCCATAGGTACTTTGTTACACGG[G/A]TAAGGCAATGTGTTGTACATCAAATTGCAATTAATCTACAATAAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075054 Nonsense 121 364 5 10
ENSDART00000143705 Nonsense 97 959 3 17
ENSDART00000147371   None 636 None 9

The following transcripts of ENSDARG00000053082 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8260570)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8563090
GRCz11 13 8895113
KASP Assay ID:
554-7577.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCATTGGGTAGTGGTCCAGATTGGCTACAGGAGCAAATGGTTAGATG[T/A]CTGTCTGAGGGTCTGTCTGCTGCTTTCTCCTCTGCAAGCACAGATCAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Hair morphology: Common variants in the trichohyalin gene are associated with straight hair in Europeans. (View Study)
  • Multiple sclerosis: Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. (View Study)
  • Orofacial clefts: Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. (View Study)
  • Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)
  • Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
  • Polycystic ovary syndrome: Genome-wide association study identifies susceptibility loci for polycystic ovary syndrome on chromosome 2p16.3, 2p21 and 9q33.3. (View Study)
  • Prostate cancer: Identification of seven new prostate cancer susceptibility loci through a genome-wide association study. (View Study)
  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link