zgc:136839

Ensembl ID:
ENSDARG00000053074
ZFIN ID:
ZDB-GENE-060616-326
Description:
PDZ domain-containing protein GIPC3 [Source:RefSeq peptide;Acc:NP_001038783]
Human Orthologue:
GIPC3
Human Description:
GIPC PDZ domain containing family, member 3 [Source:HGNC Symbol;Acc:18183]
Mouse Orthologue:
Gipc3
Mouse Description:
GIPC PDZ domain containing family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2387006]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29702 Essential Splice Site Mutation detected in F1 DNA During 2018
sa3151 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa29702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075049 Essential Splice Site 220 333 4 7
Genomic Location (Zv9):
Chromosome 22 (position 3303854)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3301168
GRCz11 22 3320436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGATGGTTTGTGTGTGTTTCTCTTTTCTCTGTGTGTTTGTGTGATTCA[G/A]ACATGATCGGTCAGAGGACTCGGGCCCCTAAGTCCAGCGAGGGGAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3151
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075049 Essential Splice Site None 333 6 7
Genomic Location (Zv9):
Chromosome 22 (position 3308168)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3305482
GRCz11 22 3324750
KASP Assay ID:
554-2471.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGATGTTTGGGGCGCTTTGGGCGACGTCAAGAATGGACGCCTTTAAAGG[T/C]GAGATCATGAAGGTAGAATTATTGGTAACTAATTTTGTTAACTAAGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link