Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wrn
- Ensembl ID:
- ENSDARG00000053065
- ZFIN ID:
- ZDB-GENE-070702-2
- Human Orthologue:
- WRN
- Human Description:
- Werner syndrome, RecQ helicase-like [Source:HGNC Symbol;Acc:12791]
- Mouse Orthologue:
- Wrn
- Mouse Description:
- Werner syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:109635]
Alleles
There are 6 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa41585 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa34829 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa34828 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa34827 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa34826 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa34825 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41585
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074986 | Essential Splice Site | 257 | 1387 | 8 | 35 |
| ENSDART00000136531 | Essential Splice Site | 241 | 1426 | 9 | 37 |
- Genomic Location (Zv9):
- Chromosome 10 (position 6133990)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 7577157 GRCz11 10 7535857 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCATGATTGTTATTATCATATGCTTACATGTTATATATGTGTTTTTGCA[G/A]TGCTGGGAGACTAGTGGATGATCTGTCTCAAACTCTTACATCTCTAAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34829
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074986 | Nonsense | 431 | 1387 | 11 | 35 |
| ENSDART00000136531 | Nonsense | 415 | 1426 | 12 | 37 |
- Genomic Location (Zv9):
- Chromosome 10 (position 6130140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 7573307 GRCz11 10 7532007 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAATGTCTGTTTCTGTTAAGATTCAAGCATTCCACAGCCAGTTCCTGAA[C/T]AAATCAAATGTCTGAAAATGTTCTTTGGACATCACAGTTTCAAACCGTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34828
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074986 | Nonsense | 787 | 1387 | 20 | 35 |
| ENSDART00000136531 | Nonsense | 827 | 1426 | 22 | 37 |
- Genomic Location (Zv9):
- Chromosome 10 (position 6113831)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 7556998 GRCz11 10 7515698 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCCAAAGATTCATTCTCAACCAATCCAAAAGTGAGCGCTTCAGGAGTTA[C/A]AAAATAGACATGATGGCAAAAATGGAAAAGTATCTGAATTCAACCAAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34827
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074986 | Essential Splice Site | 1167 | 1387 | 30 | 35 |
| ENSDART00000136531 | Essential Splice Site | 1200 | 1426 | 32 | 37 |
- Genomic Location (Zv9):
- Chromosome 10 (position 6098140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 7541307 GRCz11 10 7500007 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCATCTCCATCACATACAGCCTTTTCCAGATAGAGCACAAGAGCTTGG[T/C]ACAACATTCACTTCCTAATCCTTACTTTAGCTGTAGTGTTTGTTAGTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34826
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074986 | Nonsense | 1341 | 1387 | 34 | 35 |
| ENSDART00000136531 | Nonsense | 1374 | 1426 | 36 | 37 |
- Genomic Location (Zv9):
- Chromosome 10 (position 6091957)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 7535124 GRCz11 10 7493824 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGAATGGAGCTGGCTTCCTGGAACCAGGATAACCTGGATAAGGACACA[C/T]AAGATCTCTTCAGCGATTCCCCTGTGAAGGTAGGACAGCTGGTTGAGTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34825
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074986 | Essential Splice Site | 1350 | 1387 | 34 | 35 |
| ENSDART00000136531 | Essential Splice Site | 1383 | 1426 | 36 | 37 |
- Genomic Location (Zv9):
- Chromosome 10 (position 6091927)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 7535094 GRCz11 10 7493794 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAACCTGGATAAGGACACACAAGATCTCTTCAGCGATTCCCCTGTGAAG[G/A]TAGGACAGCTGGTTGAGTACAGCTGATTTCAACATTGCTCCTAAGAAATG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Exercise treadmill test traits: Genome-wide association of echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Heart Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
