zgc:112165

Ensembl ID:
ENSDARG00000053010
ZFIN ID:
ZDB-GENE-050522-229
Description:
Lysophosphatidylcholine acyltransferase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q502J0]
Human Orthologue:
LPCAT2
Human Description:
lysophosphatidylcholine acyltransferase 2 [Source:HGNC Symbol;Acc:26032]
Mouse Orthologues:
Lpcat2, Lpcat2b
Mouse Descriptions:
lysophosphatidylcholine acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:3606214]
lysophosphatidylcholine acyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1918152]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6082 Nonsense Mutation detected in F1 DNA During 2018
sa31581 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074963 Nonsense 333 529 10 14
ENSDART00000128334 Nonsense 333 529 10 15
Genomic Location (Zv9):
Chromosome 7 (position 36854007)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35127850
GRCz11 7 35399327
KASP Assay ID:
554-3784.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGACTCTGCCTATGGAAGCTGGACTAGTGGAGTTTACCAAGAYCAGC[A/T]GAAAATTGGAGTAAGAAAAYAGTTTATACGTGTAATTTTAAGAATACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074963   None 529 14 14
ENSDART00000128334 Essential Splice Site None 529 14 15
Genomic Location (Zv9):
Chromosome 7 (position 36848357)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35122200
GRCz11 7 35393677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAGATGACTGACTCAGATGAAGGAGATTGAGCATGCAGACATAAGG[G/A]TAATACTCCAAGCCATGCCATCTGAACATGTGCCTTAAGCCTGCATGGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link