zgc:113162

Ensembl ID:
ENSDARG00000052923
ZFIN ID:
ZDB-GENE-050522-530
Description:
hypothetical protein LOC553743 [Source:RefSeq peptide;Acc:NP_001018550]
Human Orthologues:
TESK1, TESK2
Human Descriptions:
testis-specific kinase 1 [Source:HGNC Symbol;Acc:11731]
testis-specific kinase 2 [Source:HGNC Symbol;Acc:11732]
Mouse Orthologues:
Tesk1, Tesk2
Mouse Descriptions:
testis specific protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1201675]
testis-specific kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2385204]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa777 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa777
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074865 Nonsense 230 315 8 10
ENSDART00000134347 Nonsense 235 320 6 8
Genomic Location (Zv9):
Chromosome 21 (position 11624038)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13325212
GRCz11 21 13421941
KASP Assay ID:
554-0682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATCTGTTTATGCTGCTTTCTCTGTTTAATCACAGGTGGATGTTTTCT[C/A]GTTCGGGATCATGTTGTGTGAGATCTTAGCAAGAATTCCTGCTGATCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link