tpra
- Ensembl ID:
- ENSDARG00000052914
- ZFIN ID:
- ZDB-GENE-081104-2
- Description:
- Novel protein similar to vertebrate translocated promoter region (To activated MET oncogene) (TPR) [
- Human Orthologue:
- TPR
- Human Description:
- translocated promoter region (to activated MET oncogene) [Source:HGNC Symbol;Acc:12017]
- Mouse Orthologue:
- Tpr
- Mouse Description:
- translocated promoter region Gene [Source:MGI Symbol;Acc:MGI:1922066]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa10563 |
Nonsense |
Available for shipment |
Available now |
sa32892 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa32891 |
Nonsense |
Available for shipment |
Available now |
sa19727 |
Nonsense |
Available for shipment |
Available now |
sa25104 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa32890 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa10563
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 20660889)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
21206827 |
GRCz11 |
2 |
20864889 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATAACATGATTGCGTGTGTTTTGATTGTTAAGTGGAAGAGCTTAAGAAGT[T/G]AAAAGAGATAGAAGAAGTGCAGGGAACAAYGCAAGAGGTAACTATTTGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32892
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 20659360)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
21205298 |
GRCz11 |
2 |
20863360 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTAAATGGTGTACTTCACTTTGTTTCAGTATCGTGAGAAGCGGATGGAA[C/T]AAGAAAAAGAGCTTCTCCAGAACCAGAACACATGGCTGAACACAGAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32891
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 20658881)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
21204819 |
GRCz11 |
2 |
20862881 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGAAGTACCGCAATGAGCTGAATGCAAACCTCAAACTATGTAATTTGTA[C/A]AAGGTCAGTTAAACATTTATTTATTTATTTATTTTATTGACTTGCTGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19727
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 20645256)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
21191194 |
GRCz11 |
2 |
20849256 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGAGGTGGAAACCAAAGCTCCCATCCTGAAACGCCAGAGAGAGGAATA[T/G]GAGAGCATGCAGAAGTCTATGACCAGTCTCTGTTATAAACTAGAGCAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25104
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 20645198)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
21191136 |
GRCz11 |
2 |
20849198 |
- KASP Assay ID:
- 554-7472.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCAGAAGTCTATGACCAGTCTCTGTTATAAACTAGAGCAAGCTATGAAG[G/A]TTTGCACACATTTGAGAGCTAATGCAAAAAGAAGGAACAGGATAATGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32890
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 20596879)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
21166302 |
GRCz11 |
2 |
20824364 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCAACCCTCTGAGTCTCAGATCAGTGGACAGGACTCATCAGAAGAGTA[C/A]AAGCATGATGTAATCGTCATCGAAACAGACAGCGCCACTGAGGAGGAGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: