WNT8A_DANRE

Ensembl ID:
ENSDARG00000052910
Description:
Protein Wnt-8a [Source:UniProtKB/Swiss-Prot;Acc:P51028]
Human Orthologue:
WNT8A
Human Description:
wingless-type MMTV integration site family, member 8A [Source:HGNC Symbol;Acc:12788]
Mouse Orthologue:
Wnt8a
Mouse Description:
wingless-related MMTV integration site 8A Gene [Source:MGI Symbol;Acc:MGI:107924]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35723 Essential Splice Site Available for shipment Available now
sa44812 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017635 Essential Splice Site None 359 None 7
ENSDART00000132193 Essential Splice Site 8 387 None 7
ENSDART00000144301   None 264 1 6
ENSDART00000148044   None 161 None 6
ENSDART00000017635 Essential Splice Site None 359 None 7
ENSDART00000132193 Essential Splice Site 8 387 None 7
ENSDART00000144301   None 264 1 6
ENSDART00000148044   None 161 None 6

The following transcripts of ENSDARG00000052910 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35622725)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34152002
GRCz11 14 34492316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCAAGCAGTCAGTCACTTGTCGTCTGTCTCTTGTGCGTATCCATCTC[A/G]GTGTTTGTGCTTTGCATCTCAAGAAGAAGGGAGGATCGAGCAATCACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017635 Nonsense 212 359 7 7
ENSDART00000132193 Nonsense 240 387 7 7
ENSDART00000144301 Nonsense 212 263 6 6
ENSDART00000148044   None 161 None 6

The following transcripts of ENSDARG00000052910 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35624425)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34153702
GRCz11 14 34494016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGATGCAGCTTGCTGATTTCAGAGATATCGGCTCCTACCTAAAAATC[A/T]AGCATGATCAAGCACGGAAGTTGGAGATGGATAAAATTCGGATGAGGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link