si:dkey-264m23.3

Ensembl ID:
ENSDARG00000052903
ZFIN IDs:
ZDB-GENE-040912-64, ZDB-GENE-091204-360
Description:
hypothetical protein LOC447899 [Source:RefSeq peptide;Acc:NP_001004637]
Human Orthologue:
RTKN
Human Description:
rhotekin [Source:HGNC Symbol;Acc:10466]
Mouse Orthologue:
Rtkn
Mouse Description:
rhotekin Gene [Source:MGI Symbol;Acc:MGI:107371]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43591 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074845 Nonsense 239 243 6 7
ENSDART00000122331 Nonsense 495 499 12 13
Genomic Location (Zv9):
Chromosome 21 (position 9698624)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11181940
GRCz11 21 11274568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACAGACCAGTTTCTTCTGAGATCCAGAGTCTGCTGTCCACCTATTA[T/G]AATGACAGGTGAAGATAAGCACATAAACGCACACACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link