
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-165i4.1
- Ensembl ID:
- ENSDARG00000052897
- ZFIN ID:
- ZDB-GENE-060526-217
- Description:
- ataxin-2 [Source:RefSeq peptide;Acc:NP_001121821]
- Human Orthologue:
- ATXN2
- Human Description:
- ataxin 2 [Source:HGNC Symbol;Acc:10555]
- Mouse Orthologue:
- Atxn2
- Mouse Description:
- ataxin 2 Gene [Source:MGI Symbol;Acc:MGI:1277223]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa870 | Essential Splice Site | Available for shipment | Available now |
sa16931 | Essential Splice Site | Available for shipment | Available now |
sa40527 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33679 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33678 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa870
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083656 | Essential Splice Site | 95 | 1112 | 4 | 23 |
- Genomic Location (Zv9):
- Chromosome 5 (position 43324474)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 41105739 GRCz11 5 41705892 - KASP Assay ID:
- 554-0772.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAAAATGGCCTGATCTATGAAGGGGTTTTTAAAACATATGGCCCAGAGG[T/C]AAGGATACCACTTTGTATTGCTGATGTTAAGCATTTCTATCACTGTTAAG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa16931
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083656 | Essential Splice Site | 146 | 1112 | 5 | 23 |
- Genomic Location (Zv9):
- Chromosome 5 (position 43324192)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 41105457 GRCz11 5 41705610 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTAGTRGTARTTCATTTCAAAGATGTGGAYCTCAACTATGCCAAGAAAGG[T/C]GAGAYCTTCTGTCAAATATTCTTGYTACTTTAATRGGYGTTTTACAGGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40527
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083656 | Nonsense | 590 | 1112 | 15 | 23 |
- Genomic Location (Zv9):
- Chromosome 5 (position 43288896)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 41070161 GRCz11 5 41670314 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAGAAGCTTCCATTCTTCCATTCACTAAAGCACTGCATTTTTTTGTAGT[T/A]GCAGCCTAGCTCAAGTTCAGATCCAGGTTTTGAAGCTATGGGGACCAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33679
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083656 | Nonsense | 751 | 1112 | 17 | 23 |
- Genomic Location (Zv9):
- Chromosome 5 (position 43286205)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 41067470 GRCz11 5 41667623 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCCCACTCTGACCCGACCCCAGGGTCAACCCAGCCCTTCCATCGTTGTA[C/T]AGCAGCCTCCTACGGTCTACGGCCAGACCATGTTCCAGATGTACCCGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33678
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000083656 | Essential Splice Site | 923 | 1112 | 20 | 23 |
- Genomic Location (Zv9):
- Chromosome 5 (position 43271715)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 41052980 GRCz11 5 41653133 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTAAGAACTTCCCCAGCACAATGACTAAGCTCAACAAGCCCACATACAGT[G/A]TCACTGCTATGTATTGCTTTTCTTTTCGATAAATAACTCAACTCTACAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Beta-2 microglubulin plasma levels: Genome-wide association study identified the human leukocyte antigen region as a novel locus for plasma beta-2 microglobulin. (View Study)
- Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
- Celiac disease: Newly identified genetic risk variants for celiac disease related to the immune response. (View Study)
- Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
- Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
- Other erythrocyte phenotypes: Multiple loci influence erythrocyte phenotypes in the CHARGE Consortium. (View Study)
- Red blood cell traits: Seventy-five genetic loci influencing the human red blood cell. (View Study)
- Retinal vascular caliber: Four novel Loci (19q13, 6q24, 12q24, and 5q14) influence the microcirculation in vivo. (View Study)
- Systolic blood pressure: Genome-wide association study identifies eight loci associated with blood pressure. (View Study)
- Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: