zgc:136337

Ensembl ID:
ENSDARG00000052896
ZFIN ID:
ZDB-GENE-060616-45
Description:
retina specific protein PAL [Source:RefSeq peptide;Acc:NP_001036218]
Human Orthologue:
LRIT1
Human Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 [Source:HGNC Symbol;Acc:23404]
Mouse Orthologue:
Lrit1
Mouse Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14614 Nonsense Available for shipment Available now
sa16203 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127706 Nonsense 419 654 4 4
Genomic Location (Zv9):
Chromosome 12 (position 50587199)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48954043
GRCz11 12 48975572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGATCGAGAGCTACAGCRTTTCAGCAGACGCATCAAAGCYGAAGCCA[A/T]AGCCAAAGCCAACAGCGCCCCCTGTGGGGCAGACGGAGCCRGTGGCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127706 Nonsense 590 654 4 4
Genomic Location (Zv9):
Chromosome 12 (position 50587712)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48954556
GRCz11 12 48976085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCGTCTGCTGCGGAGCGCTGAAGCGGCGTCTGCAGAAGCTGCTGGGC[C/T]GAAAGTCCAAAGACATCCAGGACTCCTATGTGACATTCGAGACGCTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link