zgc:91963

Ensembl ID:
ENSDARG00000052895
ZFIN ID:
ZDB-GENE-040801-245
Description:
hypothetical protein LOC445108 [Source:RefSeq peptide;Acc:NP_001003502]
Human Orthologue:
HTRA3
Human Description:
HtrA serine peptidase 3 [Source:HGNC Symbol;Acc:30406]
Mouse Orthologue:
Htra3
Mouse Description:
HtrA serine peptidase 3 Gene [Source:MGI Symbol;Acc:MGI:1925808]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32726 Nonsense Mutation detected in F1 DNA During 2018
sa19541 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080563 Nonsense 84 386 1 8
ENSDART00000147672 Nonsense 84 382 1 7
Genomic Location (Zv9):
Chromosome 1 (position 41138369)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40038802
GRCz11 1 40741589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGTCCTGTGCGGCGACGGGCTGGAATGTAAATTTCCGACCGGTAAA[C/T]GACTTTCTAAAGGTGTTTGCCAGTGTAAGACCATTCACAGAGTATGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080563 Essential Splice Site 249 386 4 8
ENSDART00000147672 Essential Splice Site 249 382 4 7
Genomic Location (Zv9):
Chromosome 1 (position 41149020)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40049453
GRCz11 1 40752240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTCCAAATTAATTACTTTACATGATTTGTTGTGTTCATTTCTCCTGC[A/T]GAAGAAATTACAGGTCTTATCATTAGGTCGCTCTGCTGACCTGAGGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link